antisense oligonucleotides Search Results


94
Integrated DNA Technologies antisense oligonucleotides
Antisense Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/Antisense+Oligos/10__1158_slash_1078___0432__ccr___12___0792-77-4-9
Average 94 stars, based on 1 article reviews
antisense oligonucleotides - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Santa Cruz Biotechnology antisense oligonucleotide
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/MAP+Kinase+Antisense+Oligonucleotide/pm12507930-115-9-21
Average 86 stars, based on 1 article reviews
antisense oligonucleotide - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

90
GeneWorks 20-mer p21 antisense oligonucleotide (tccccagccggttctgacat)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
20 Mer P21 Antisense Oligonucleotide (Tccccagccggttctgacat), supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/20+mer+p21+antisense+oligonucleotide++tccccagccggttctgacat+/10__1074_slash_jbc__m004424200-88-19-31
Average 90 stars, based on 1 article reviews
20-mer p21 antisense oligonucleotide (tccccagccggttctgacat) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag 0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
0.1–1.0 μm Of Antisense Gene Specific Oligonucleotide Primer (Mwgbiotech, High Point, Nc), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/0+1+1+0+%CE%BCm+of+antisense+gene+specific+oligonucleotide+primer++mwgbiotech++high+point++nc+/pmc02576272-315-20-24
Average 90 stars, based on 1 article reviews
0.1–1.0 μm of antisense gene-specific oligonucleotide primer (mwgbiotech, high point, nc) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Hisamitsu Pharmaceutical Co Inc antisense oligonucleotide
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide, supplied by Hisamitsu Pharmaceutical Co Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/antisense+oligonucleotide/us08114884-52-9-3
Average 90 stars, based on 1 article reviews
antisense oligonucleotide - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
CH Instruments antisense oligonucleotide targeted to ache mrna
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide Targeted To Ache Mrna, supplied by CH Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/antisense+oligonucleotide+targeted+to+ache+mrna/us06987211-912-43-45
Average 90 stars, based on 1 article reviews
antisense oligonucleotide targeted to ache mrna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Antisense Therapeutics phosphorodiamidate morpholino oligonucleotides (pmos)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Phosphorodiamidate Morpholino Oligonucleotides (Pmos), supplied by Antisense Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/phosphorodiamidate+morpholino+oligonucleotides++pmos+/pm19004840-41-25-13
Average 90 stars, based on 1 article reviews
phosphorodiamidate morpholino oligonucleotides (pmos) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Shanghai GeneCore BioTechnologies Co Ltd antisense oligonucleotides (mir inhibitors)
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotides (Mir Inhibitors), supplied by Shanghai GeneCore BioTechnologies Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/antisense+oligonucleotides++mir+inhibitors+/pmc04558514-170-7-14
Average 90 stars, based on 1 article reviews
antisense oligonucleotides (mir inhibitors) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Regulus Therapeutics antisense oligonucleotide inhibitors with nucleoside sugar modifications (2′ o methoxyethyl), with phosphodiester (po), phosphorothioate, and mixed ps/po backbones
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotide Inhibitors With Nucleoside Sugar Modifications (2′ O Methoxyethyl), With Phosphodiester (Po), Phosphorothioate, And Mixed Ps/Po Backbones, supplied by Regulus Therapeutics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/antisense+oligonucleotide+inhibitors+with+nucleoside+sugar+modifications++2++o+methoxyethyl+++with+phosphodiester++po+++phosphorothioate++and+mixed+ps+po+backbones/pmc04772951-224-11-22
Average 90 stars, based on 1 article reviews
antisense oligonucleotide inhibitors with nucleoside sugar modifications (2′ o methoxyethyl), with phosphodiester (po), phosphorothioate, and mixed ps/po backbones - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co mir-147 mimic
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Mir 147 Mimic, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/chemically+modified+antisense+rna+oligonucleotide+against+mir+147a/pmc04727187-162-0-14
Average 90 stars, based on 1 article reviews
mir-147 mimic - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Ribobio co antisense oligonucleotides targeting linc01852
Fig. 11. Effect of two different <t>antisense</t> oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.
Antisense Oligonucleotides Targeting Linc01852, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/antisense+oligonucleotides+targeting+linc01852/pm38263157-51-12-17
Average 90 stars, based on 1 article reviews
antisense oligonucleotides targeting linc01852 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
RiboTask Inc antisense mir155 lna oligonucleotide
Higher expression of <t>miR155</t> and HO‐1 in TSC and FCD IIb. ( A ) Expression of miR155 was predominately found in neurones of the grey matter (GM) with low expression in glia of the white matter (WM) (arrowheads). ( B, C ) In contrast, miR155 expression was predominantly found in GFAP‐positive cells with glial morphology and giant/balloon cells in FCD IIb and TSC as compared to control, whereas expression in dysmorphic neurones did not differ from control. ( D ) Expression of total miR155 in TSC tissue was higher than in control. ( E, F ) Moreover, HO‐1 RNA expression was higher in surgically resected tuber tissue from TSC patients compared to autoptic control, while HO‐1 protein expression was high only in a subset of patients. ( G, H ) miR155 expression was not different between autopsy control tissue and FCD IIb, while HO‐1 RNA was higher. Mann–Whitney U test. Data are expressed relative to expression observed in controls. Error bars represent range; ** P < 0.01. n = 8 (Autopsy control, FCD IIb), n = 10 (TSC). Scale bar 100 µm in A (representative for A‐C), arrows = dysmorphic neurones, arrowheads = glia, asterisk = balloon/giant cells. [Colour figure can be viewed at wileyonlinelibrary.com ]
Antisense Mir155 Lna Oligonucleotide, supplied by RiboTask Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/antisense+oligonucleotides/antisense+mir155+lna+oligonucleotide/pmc07308211-60-20-26
Average 90 stars, based on 1 article reviews
antisense mir155 lna oligonucleotide - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Fig. 11. Effect of two different antisense oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.

Journal: Carcinogenesis

Article Title: Development and molecular characterization of HCT-116 cell lines resistant to the tumor promoter and multiple stress-inducer, deoxycholate.

doi: 10.1093/carcin/23.12.2063

Figure Lengend Snippet: Fig. 11. Effect of two different antisense oligonucleotides, one targeted at the ATG codon (Oligo #1) and another 3 of the ATG codon selected on the basis of better secondary probe characteristics (Oligo #9) on DOC-induced apoptosis in resistant cell line HCT-116 RC.

Article Snippet: After 24 or 48 h of treatment with the antisense oligonucleotide, cells were fixed and stained with an antibody to p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) to determine the amount of reduction in protein expression.

Techniques:

Fig. 12. Down-regulation of NF-κB (p65) protein level in HCT-116RC cells by an antisense oligonucleotide. (A, B) Confocal images of cells stained with an antibody to p65 protein (red). Treatment with an antisense oligonucleotide (A) shows a decrease in p65 protein levels when compared with untreated control (B). Green fluorescence (C) indicates uptake of the p65 antisense oligonucleotides. (D) Immunocontrol for panels A and B, in which the primary antibody was omitted; minimal background fluorescence is shown.

Journal: Carcinogenesis

Article Title: Development and molecular characterization of HCT-116 cell lines resistant to the tumor promoter and multiple stress-inducer, deoxycholate.

doi: 10.1093/carcin/23.12.2063

Figure Lengend Snippet: Fig. 12. Down-regulation of NF-κB (p65) protein level in HCT-116RC cells by an antisense oligonucleotide. (A, B) Confocal images of cells stained with an antibody to p65 protein (red). Treatment with an antisense oligonucleotide (A) shows a decrease in p65 protein levels when compared with untreated control (B). Green fluorescence (C) indicates uptake of the p65 antisense oligonucleotides. (D) Immunocontrol for panels A and B, in which the primary antibody was omitted; minimal background fluorescence is shown.

Article Snippet: After 24 or 48 h of treatment with the antisense oligonucleotide, cells were fixed and stained with an antibody to p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) to determine the amount of reduction in protein expression.

Techniques: Staining, Control

Fig. 13. Effects of missense and antisense p65 oligonucleotides (probe #9) on DOC-induced apoptosis of cells of resistant cell line HCT-116RC. The secondary structure of the missense probe was designed to match that of the antisense probe #9.

Journal: Carcinogenesis

Article Title: Development and molecular characterization of HCT-116 cell lines resistant to the tumor promoter and multiple stress-inducer, deoxycholate.

doi: 10.1093/carcin/23.12.2063

Figure Lengend Snippet: Fig. 13. Effects of missense and antisense p65 oligonucleotides (probe #9) on DOC-induced apoptosis of cells of resistant cell line HCT-116RC. The secondary structure of the missense probe was designed to match that of the antisense probe #9.

Article Snippet: After 24 or 48 h of treatment with the antisense oligonucleotide, cells were fixed and stained with an antibody to p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) to determine the amount of reduction in protein expression.

Techniques:

Higher expression of miR155 and HO‐1 in TSC and FCD IIb. ( A ) Expression of miR155 was predominately found in neurones of the grey matter (GM) with low expression in glia of the white matter (WM) (arrowheads). ( B, C ) In contrast, miR155 expression was predominantly found in GFAP‐positive cells with glial morphology and giant/balloon cells in FCD IIb and TSC as compared to control, whereas expression in dysmorphic neurones did not differ from control. ( D ) Expression of total miR155 in TSC tissue was higher than in control. ( E, F ) Moreover, HO‐1 RNA expression was higher in surgically resected tuber tissue from TSC patients compared to autoptic control, while HO‐1 protein expression was high only in a subset of patients. ( G, H ) miR155 expression was not different between autopsy control tissue and FCD IIb, while HO‐1 RNA was higher. Mann–Whitney U test. Data are expressed relative to expression observed in controls. Error bars represent range; ** P < 0.01. n = 8 (Autopsy control, FCD IIb), n = 10 (TSC). Scale bar 100 µm in A (representative for A‐C), arrows = dysmorphic neurones, arrowheads = glia, asterisk = balloon/giant cells. [Colour figure can be viewed at wileyonlinelibrary.com ]

Journal: Neuropathology and Applied Neurobiology

Article Title: Chronic activation of anti‐oxidant pathways and iron accumulation in epileptogenic malformations

doi: 10.1111/nan.12596

Figure Lengend Snippet: Higher expression of miR155 and HO‐1 in TSC and FCD IIb. ( A ) Expression of miR155 was predominately found in neurones of the grey matter (GM) with low expression in glia of the white matter (WM) (arrowheads). ( B, C ) In contrast, miR155 expression was predominantly found in GFAP‐positive cells with glial morphology and giant/balloon cells in FCD IIb and TSC as compared to control, whereas expression in dysmorphic neurones did not differ from control. ( D ) Expression of total miR155 in TSC tissue was higher than in control. ( E, F ) Moreover, HO‐1 RNA expression was higher in surgically resected tuber tissue from TSC patients compared to autoptic control, while HO‐1 protein expression was high only in a subset of patients. ( G, H ) miR155 expression was not different between autopsy control tissue and FCD IIb, while HO‐1 RNA was higher. Mann–Whitney U test. Data are expressed relative to expression observed in controls. Error bars represent range; ** P < 0.01. n = 8 (Autopsy control, FCD IIb), n = 10 (TSC). Scale bar 100 µm in A (representative for A‐C), arrows = dysmorphic neurones, arrowheads = glia, asterisk = balloon/giant cells. [Colour figure can be viewed at wileyonlinelibrary.com ]

Article Snippet: For transfection, cultures were transfected with either mimic negative control (Figure ), miR155 mimic (Applied Biosystems, Carlsbad, CA, USA) or antisense miR155 LNA oligonucleotide (miR155 antagomiR, Ribotask ApS, Odense, Denmark) (Table ).

Techniques: Expressing, Control, RNA Expression, MANN-WHITNEY

Higher expression of 4‐HNE, HO‐1 and miR155 in Tsc1 GFAP−/− mice precedes the development of seizures. ( A, B ) Expression of 4‐HNE in the hippocampus (HC) and cortex (Cx) of 2‐week‐old control mice was low while it was detectable in 2‐week‐old Tsc1 GFAP−/− mice before seizure onset, however, only in the hippocampus mainly perivascular and in GFAP and occasionally NeuN expressing cells, but not Iba‐1‐positive cells ( B 1 –B 3 ). ( C, D ) 4‐HNE expression was higher in the hippocampus of 2‐month‐old control mice after seizure onset compared to 2‐week‐old control mice before seizure onset. Two‐month‐old Tsc1 GFAP−/− mice with recurrent seizures displayed high 4‐HNE expression in the hippocampus and cortex with similar perivascular expression and co‐localization with GFAP‐positive cells as in 2‐week‐old mice ( D 1 –D 3 ). ( E, G ) HO‐1 was moderately expressed in the hippocampus and cortex of 2‐week‐old and 2‐month‐old control mice. ( F ) In contrast, 2‐week‐old Tsc1 GFAP−/− mice showed very high expression in sparsely distributed GFAP‐positive cells mainly in the hippocampus before seizure onset (arrowheads, F 1 ). Iba‐1‐positive cells were in close proximity to the HO‐1 expressing cells, but did not show co‐localization ( F 2,3 ). ( H ) In 2‐month‐old Tsc1 GFAP−/− mice with recurrent seizures the number of cells displaying strong HO‐1 expression was higher than in animals before seizure onset and could also be found in the cortex. ( I–J ) Quantification of 4‐HNE OD revealed higher 4‐HNE reactivity in 2‐week‐old animals in the HC and in HC and Cx in 2‐month‐old mice. ( K ) Additionally, the count of cells with strong HO‐1 expression increased in the HC and Cx in 2‐month‐old mice after seizure development ( F 1 , H 1 ). ( L–O ) RNA quantification of miR155 and HO‐1 in the hippocampus and cortex revealed higher expression in Tsc1 GFAP−/− mice already before seizure onset compared to control, which was even higher in mice after the development of recurrent seizures. Scale bars: 500 µm (hippocampus) and 100 µm (cortex) in A, 50µm in B 1 (representative of B 1 –B 3 , D 1 –D 3 ) and 20 µm in insert in F 1 (representative of F 1 –F 3 , H 1 –H 3 ). Mann–Whitney U test. Data are expressed relative to expression observed in WT for the respective age group and presented as individual data points as well as in box plots. Error bars represent range; * P < 0.05, ** P < 0.01 (L‐O ## P < 0.01 2‐week‐old vs. 2‐month‐old Tsc1 GFAP−/− mice). n = 5 animals per group. [Colour figure can be viewed at wileyonlinelibrary.com ]

Journal: Neuropathology and Applied Neurobiology

Article Title: Chronic activation of anti‐oxidant pathways and iron accumulation in epileptogenic malformations

doi: 10.1111/nan.12596

Figure Lengend Snippet: Higher expression of 4‐HNE, HO‐1 and miR155 in Tsc1 GFAP−/− mice precedes the development of seizures. ( A, B ) Expression of 4‐HNE in the hippocampus (HC) and cortex (Cx) of 2‐week‐old control mice was low while it was detectable in 2‐week‐old Tsc1 GFAP−/− mice before seizure onset, however, only in the hippocampus mainly perivascular and in GFAP and occasionally NeuN expressing cells, but not Iba‐1‐positive cells ( B 1 –B 3 ). ( C, D ) 4‐HNE expression was higher in the hippocampus of 2‐month‐old control mice after seizure onset compared to 2‐week‐old control mice before seizure onset. Two‐month‐old Tsc1 GFAP−/− mice with recurrent seizures displayed high 4‐HNE expression in the hippocampus and cortex with similar perivascular expression and co‐localization with GFAP‐positive cells as in 2‐week‐old mice ( D 1 –D 3 ). ( E, G ) HO‐1 was moderately expressed in the hippocampus and cortex of 2‐week‐old and 2‐month‐old control mice. ( F ) In contrast, 2‐week‐old Tsc1 GFAP−/− mice showed very high expression in sparsely distributed GFAP‐positive cells mainly in the hippocampus before seizure onset (arrowheads, F 1 ). Iba‐1‐positive cells were in close proximity to the HO‐1 expressing cells, but did not show co‐localization ( F 2,3 ). ( H ) In 2‐month‐old Tsc1 GFAP−/− mice with recurrent seizures the number of cells displaying strong HO‐1 expression was higher than in animals before seizure onset and could also be found in the cortex. ( I–J ) Quantification of 4‐HNE OD revealed higher 4‐HNE reactivity in 2‐week‐old animals in the HC and in HC and Cx in 2‐month‐old mice. ( K ) Additionally, the count of cells with strong HO‐1 expression increased in the HC and Cx in 2‐month‐old mice after seizure development ( F 1 , H 1 ). ( L–O ) RNA quantification of miR155 and HO‐1 in the hippocampus and cortex revealed higher expression in Tsc1 GFAP−/− mice already before seizure onset compared to control, which was even higher in mice after the development of recurrent seizures. Scale bars: 500 µm (hippocampus) and 100 µm (cortex) in A, 50µm in B 1 (representative of B 1 –B 3 , D 1 –D 3 ) and 20 µm in insert in F 1 (representative of F 1 –F 3 , H 1 –H 3 ). Mann–Whitney U test. Data are expressed relative to expression observed in WT for the respective age group and presented as individual data points as well as in box plots. Error bars represent range; * P < 0.05, ** P < 0.01 (L‐O ## P < 0.01 2‐week‐old vs. 2‐month‐old Tsc1 GFAP−/− mice). n = 5 animals per group. [Colour figure can be viewed at wileyonlinelibrary.com ]

Article Snippet: For transfection, cultures were transfected with either mimic negative control (Figure ), miR155 mimic (Applied Biosystems, Carlsbad, CA, USA) or antisense miR155 LNA oligonucleotide (miR155 antagomiR, Ribotask ApS, Odense, Denmark) (Table ).

Techniques: Expressing, Control, MANN-WHITNEY

In vitro , human foetal astrocytes displayed different response to acute vs. chronic OS and chronic HO‐1 expression can induce genes involved in iron regulation. ( A ) Acute OS rapidly induced gene expression of Nrf‐2 targets HO‐1 and xCT, while NF‐κB signalling genes TLR‐4 and TAB‐2 were downregulated. Chronic OS increased expression of HO‐1 and xCT. However, the HO‐1 increase was lower than after acute OS. Moreover, in contrast to acute OS TLR‐4, TAB‐2 and MYD88 expression was increased. ( B ) Exposure to acute OS induced rapid expression of γH2A.X in the nucleus of human foetal astrocytes compared to control (B 2 ). Quantification of cells displaying >10 γH2A.X foci could not be detected in control cells, while acute OS induced expression in approximately 55% of cells (B 3 ). ( C, D, H, I ) Transfection of foetal astrocytes with miR155 mimic induced expression of HO‐1 and xCT even in the absence of OS. This effect was preserved in cells derived from TSC patients and could be reversed by the inhibitor of miR155. ( E ) Additionally, Bach‐1 expression was lower. These effects were independent of the presence of acute (3 h) or chronic (72 h) OS. ( F, G ) Transfection of foetal astrocytes with miR155 mimic for 24 h followed by acute OS had no effect on expression of FTH‐1 and FPN‐1. In contrast, prolonged exposure to the miR155 mimic for 72 h coupled to chronic OS induced FTH‐1 and FPN‐1. ( J ) Moreover, foetal astrocytes exposed to miR155 mimic for 72 h displayed increased susceptibility to high H 2 O 2 concentrations compared to control and miR155 inhibitor transfected cells as measured using the MTT assay. ( K ) Foetal astrocytes stimulated with H 2 O 2 for different time points displayed rapid expression of HO‐1 protein which peaked at 6 h and decreased again after 24 h. In parallel, ferritin expression increased with a delay and remained high even after 24 h. Scale bar is 10 µm in B. Mann–Whitney U test in A, J. Kruskal–Wallis test followed by Dunn’s in C–I, K. Data are expressed relative to expression observed in control groups and the mean value as well as the individual data points are shown. Error bars represent SEM; * P < 0.05, ** P < 0.01, n = 3 independent cultures in duplicates ( n = 379 cells (control) and 442 cells (acute OS) in B 3 ; three single cultures for H, I, K; three independent cultures in quadruplicates for J) per experiment. [Colour figure can be viewed at wileyonlinelibrary.com ]

Journal: Neuropathology and Applied Neurobiology

Article Title: Chronic activation of anti‐oxidant pathways and iron accumulation in epileptogenic malformations

doi: 10.1111/nan.12596

Figure Lengend Snippet: In vitro , human foetal astrocytes displayed different response to acute vs. chronic OS and chronic HO‐1 expression can induce genes involved in iron regulation. ( A ) Acute OS rapidly induced gene expression of Nrf‐2 targets HO‐1 and xCT, while NF‐κB signalling genes TLR‐4 and TAB‐2 were downregulated. Chronic OS increased expression of HO‐1 and xCT. However, the HO‐1 increase was lower than after acute OS. Moreover, in contrast to acute OS TLR‐4, TAB‐2 and MYD88 expression was increased. ( B ) Exposure to acute OS induced rapid expression of γH2A.X in the nucleus of human foetal astrocytes compared to control (B 2 ). Quantification of cells displaying >10 γH2A.X foci could not be detected in control cells, while acute OS induced expression in approximately 55% of cells (B 3 ). ( C, D, H, I ) Transfection of foetal astrocytes with miR155 mimic induced expression of HO‐1 and xCT even in the absence of OS. This effect was preserved in cells derived from TSC patients and could be reversed by the inhibitor of miR155. ( E ) Additionally, Bach‐1 expression was lower. These effects were independent of the presence of acute (3 h) or chronic (72 h) OS. ( F, G ) Transfection of foetal astrocytes with miR155 mimic for 24 h followed by acute OS had no effect on expression of FTH‐1 and FPN‐1. In contrast, prolonged exposure to the miR155 mimic for 72 h coupled to chronic OS induced FTH‐1 and FPN‐1. ( J ) Moreover, foetal astrocytes exposed to miR155 mimic for 72 h displayed increased susceptibility to high H 2 O 2 concentrations compared to control and miR155 inhibitor transfected cells as measured using the MTT assay. ( K ) Foetal astrocytes stimulated with H 2 O 2 for different time points displayed rapid expression of HO‐1 protein which peaked at 6 h and decreased again after 24 h. In parallel, ferritin expression increased with a delay and remained high even after 24 h. Scale bar is 10 µm in B. Mann–Whitney U test in A, J. Kruskal–Wallis test followed by Dunn’s in C–I, K. Data are expressed relative to expression observed in control groups and the mean value as well as the individual data points are shown. Error bars represent SEM; * P < 0.05, ** P < 0.01, n = 3 independent cultures in duplicates ( n = 379 cells (control) and 442 cells (acute OS) in B 3 ; three single cultures for H, I, K; three independent cultures in quadruplicates for J) per experiment. [Colour figure can be viewed at wileyonlinelibrary.com ]

Article Snippet: For transfection, cultures were transfected with either mimic negative control (Figure ), miR155 mimic (Applied Biosystems, Carlsbad, CA, USA) or antisense miR155 LNA oligonucleotide (miR155 antagomiR, Ribotask ApS, Odense, Denmark) (Table ).

Techniques: In Vitro, Expressing, Gene Expression, Control, Transfection, Derivative Assay, MTT Assay, MANN-WHITNEY